Nie-Europese Voorouers

van

Frederik Antonie en Anna Sophia Jansen

FA JANSEN 1892  AS JANSEN 1895

Frederik Antonie Jansen (23 Julie 1892 - 9 September 1972) en Anna Sophia Jansen (28 Maart 1895 - 8 September 1972)

 Nie Europese Banier

 Pieternella Aanhaling

Die dokumente wat hier onder gelys is (klik daarop om te vertoon) is gebaseer op navorsing wat die outeur gedoen het vir ‘n werkstuk oor die nie-Europese voorsate van Frederik Antonie en Anna Sophia Jansen, sy grootouers aan vaderskant.  Die eerste resultate van die navorsing is in Desember 2000 in ‘n werkstuk, “Die nie-Europese Voorouers van Frederik Antonie en Anna Sophia Jansen” saamgevat.   Die werkstuk is in 2004 bygewerk en op die internet gepubliseer.  Wat hier volg is ’n verdere verbeterde en bygewerkte weergawe van die gepubliseerde werk en vervang dit grootliks.  Hierdie jongste aanbieding is ‘n samevatting van die oorspronklike navorsingsresultate, maar met die byvoeging van ’n meer resente en wetenskaplike siening van oorerwing.  Die leser word gevolglik aanbeveel om eers die "Voorwoord" hier onder te lees.

Proloog Inleiding Eva Maria Henrietta Ansela
    Ariaantje Helena (Kaap) Christina Jan
    Magteld Claas Helena (Timor) Constantia
    Catharina (Malabar) Anthony Catharina (Palicatta) Cecilia
Epiloog          

Behalwe vir enkele uitsonderings, onder andere die outeur se eie navorsing, is baie van die inligting wat hier weergegee word geneem uit gepubliseerde werke van erkende genealogiese navorsers.  Gepubliseerde bronne op die internet is ook geraadpleeg.  Die skrywer neem die vrymoedigheid om sodanige navorsers uit te nooi om hom te kontak indien hulle van mening mag wees dat van die inligting opgeneem is sonder voldoende erkenning aan die oorspronklike outeurs.    ‘n Volledige bronnelys is beskikbaar.

Bronnelys Nie Europese Banier

 

VOORWOORD 

Alvorens die verwantskap van Frederik en Anna Jansen met hul werklike nie-Europese voorsate ondersoek kan word, is dit eerstens nodig om die term "genetiese verwantskap" tussen opeenvolgende geslagte in 'n familie te beskryf.  Hiervoor is 'n basiese kennis van die boustene van oorerwing nodig. Die skrywer loop dus 'n ompad deur allereers te poog om die toepaslike wetenskaplike begrippe te omskryf, gevolg deur 'n kort bespreking van die Jansen-familie se genetiese samestelling.

Die skrywer verneem graag van lesers wat van mening is dat hulle kan verbeter op hierdie samevatting van wetenskaplike feite, of wat addisionele inligting tot beskikking het wat kan bydra tot die verbetering van die inhoud.   Alle kommentaar is welkom.  Die skrywer moet veral beklemtoon dat hy geen akademiese opleiding het in die betrokke studierigting nie en dat hy die feite wat hier weergegee word sonder leiding deur selfstudie bekom het.  Hy leer gevolglik graag van persone wat oor toepaslike en meerdere kennis beskik.

 

"DIT IS HAAR STORIE - EN JOUNE ......."

In 2001 het Professor Bryan Sykes van Oxford, ‘n kenner op die gebied van DNS (DNA = Engels) en menslike evolusie, ‘n uitsonderlike samevatting van sy werk oor die kartering van die genealogie van die menslike ras gepubliseer.   Sy navorsing was gebasseer op die DNS in die mitokondria van die menslike sel (mtDNS).

Mitokondria is klein struktuurtjies wat in elke sel van die menslike liggaam voorkom.  Hierdie struktuurtjies word buite die selkern in die sitoplasma van die sel gevind en nie soos verwag sou word, in die selkern waar die menslike chromosome gehuisves word nie  (Verwys in hierdie verband na die bespreking oor DNS, Chromosome en Gene hier onder).  Mitokondria se hooffunksie is om die sel te help om suurstof aan te wend om energie te produseer. 

In die middel van elke mitokondrion is ‘n kort spiraal van menslike DNS, ‘n mini-chromosoom, drieduisend keer korter as die bekende dubbel heliese spiraal van gewone DNS, die meganisme van oorerwing, wat in die kern van die menslike sel gevind word.

Professor Sykes en sy span het gevind dat mtDNS slegs deur die moeder na haar kinders oorgedra word, en nooit vanaf die vader na sy kinders nie. Hierdie bevinding het ‘n totaal nuwe konsep en begrip vir die genealogie van die mens bewerkstellig. Voorheen is sonder meer aanvaar dat familiename, of te wel vanne, wat terugdateer tot in die 1500’s en selfs tot in die 1100’s, in die geval van die Europese adel, die enigste verwysingspunt vir familie- en genealogiese navorsing was.
Hierdie begrip is later verwetenskaplik nadat bewys is dat vaders, deur hul y-chromosoom, oor die basis van oorerwing beskik.  Vadersname (die familie se van) word tot vandag toe as die uitgangspunt vir die konstruksie van genealogiese tabelle en familiestambome gebruik.   Ons weet nou dat moeders oor ‘n soortgelyke oorerwingsfaktor, en net so akkuraat soos vaders se y-chromosoom, naamlik mtDNS, beskik.

Professor Sykes het bevind dat alle lede van die menslike ras, deur mtDNS, ‘n direkte moederslyn sou hê tot by die Oer-moeder van die hele menslike ras.  Soos wat die y-chromosoom van vader na seun van geslag tot geslag oorgedra is deur die eeue, so is mtDNS slegs deur moeders van geslag tot geslag oorgedra.  Ons kan tereg praat van die genealogie van vaders en en eweneens ‘n aparte genealogie van moeders.  In genealogiese navorsing is die moeders dus so belangrik soos die vaders. 

Professor Sykes het die volgende pragtige model in sy boek, “The Seven Daughters of Eve”, gebruik om hierdie erg afgeskeepte eienskap van ons voorouers te demonstreer: 

“I am on a stage. Before me, in the dim light, all the people who have ever lived are lined up, rank upon rank, stretching far into the distance.  They make no sound that I can hear, but they are talking to each other.  I have in my hand a thread which connects me to my ancestral mother way at the back (linking all the women in my line, daughter to mother, from generation to generation).  I pull on the thread and one woman’s face in every generation, feeling the tug, looks up at me (and their faces lit up, one after the other, through the generations).   Their faces stand out from the crowd, and they are illuminated by a strange light.  These are my ancestors.  I recognise my mother in the front row, and my grandmother in the next row, but in the generations behind her the illuminated faces are unfimiliar to me.  I look down the line.  The women do not look all the same.  Some are tall, some are short, some are beautiful, some are plain, some look wealthy, others poor.  I want to ask them each in turn about their lives, their hopes and their disappointments, their joys and their sacrifices.  I speak, but they can not hear.  Yet I feel the strong connection.  These are all my mothers who passed this precious messenger (mitochondrial DNA) from one to the next through a thousand births, a thousand screams, a thousand embraces of a thousand new-born babies.

Sykes se Skare “Before me, in the dim light, all the people who have ever lived are lined up, rank upon rank, stretching far into the distance”

- Erkenning aan Callum Macdonald, Kirstenbosch, 2008

A thousand rows back stands the ancestral mother of my clan (The last to pick up her face in my line).  She in turn (Now becoming the first in line) pulls on the cord she is holding.  In the great throng a million descendants sense the tug in lines that radiate from her source.  I feel the pull in my own stomach.  On the bright stage of the living, I look right and left and sense that others feel it too.  These are all the people descending from the one clan mother.  We look at each other and sense our deep umbilical connection.  I am looking at my (genealogical) brothers and sisters.  Now that I am aware who they are, I feel we have something very deep in common.  All of the people in our clan share the very same piece of mitochondrial DNA, carried through the millenniums from generation to generation, through the family tree of mothers.  We are family!“

 

DIE GENETIESE BOUSTENE

 

DNS

Die begrip DNS (Deoksieribose Nukleutiede Suur, Afrikaans vir DNA – Deoxyribose Nucleic Acid) is bekend en meeste mense weet van die bestaan daarvan.  Maar wat is DNS?  DNS is niks anders as ’n chemiese verbinding wat lyk soos ’n trapleer (twee bene met trappe wat die twee bene aan mekaar verbind).  Hierdie trapleer is dan opgewen om twee ineengestrengelde spirale te vorm.  Vandaar die naam “dubbel heliks”.   Elk van die bene is opgebou uit molekules van Deoksieribose (vyf-koolstof suiker) wat aan mekaar verbind word deur fosfaat-molekules om lang stringe (bene van die “leer”) te vorm.

Die trappe van die leer bestaan elk uit ’n kombinasie van twee molekules (basismolekules) van óf sitosien(C) en guanien (G) óf adenien (A) en timien (T). Die A en T of G en C molekules word op hul beurt met waterstof bindings aan mekaar gebind. Een so ‘n kombinasie van fosfaat=suiker=twee basismolekules=suiker=fosfaat molekule word ’n nukleotiede genoem.

 

DNS Molekuul

Chemiese argitektuur van DNS

Voorstelling aangepas vanaf National Human Genome Research Institute

 

GENE

Die vier letters C, G, A en T vorm die alfabet van die sogenaamde genetiese kode van lewende selle.  Die letters van die alfabet langs een been van die dubbel heliks word in groepe gerangskik om aminosure te vorm. 

Basismolekules: ATGCTCGAATAAATGTCAATTTGA

Aminosure: ATG  CTC  GAA  TAA  ATG  TCA  ATT  TGA

 Aminosure word op hulle beurt gegroepeer om gene (sinne, of aantal gegroepeerde woorde) te vorm.

 Gene: <ATG  CTC  GAA  TAA>  <ATG  TCA  ATT  TGA>

 ’n Geen is niks anders as die basiese fisiese en funksionele eenheid van oorerwing.  Die gene is verantwoordelik vir die produsering van proteïn molekules.  Proteïne stel ’n sel in staat om spesifieke funksies te verrig.  So sal ’n geen dus byvoorbeeld sekere selle in staat stel om die gehoorfunksie te verrig.  Ander gene sal die kleur van oë bepaal, en nog ander sal hartweefsel vorm, ensovoorts.  Overgeset synde kan nou verstaan word dat gene die instruksies bevat wat elke lewende organisme se eienskappe en karakteristieke bepaal.  Hierdie instruksies sê aan die sel watter rol dit in die liggaam moet vervul.  DNS bevat dus die detail planne of bloudruk vir elke sel se bou en funksie.

 

CHROMOSOME

Die totale lengte van die DNS in elke menslike sel is ongeveer 1,8 meter.  Hierdie hele string van DNS bevat ongeveer 20, 000 tot 25,000 gene.  DNS word stuksgewys styf gepak saam met proteïn molekules in 46 (vir die mens) strukture wat chromosome genoem word.

Hierdie 46 chomosome is in 23 pare gerangskik.  Die eerste 22 pare word outosome genoem en die 23ste paar word die geslagschromosoompaar genoem.  Dit is hierdie 23ste chromosoompaar wat die mens se geslag bepaal.  ’n Manlike persoon sal altyd ’n kombinasie van ’n X-chromosoom en Y-chromosoom vir sy geslagschromosoompaar hê.  ’n Vroulike persoon sal op haar beurt ’n XX kombinasie vir haar 23ste chromosoompaar hê.  Daar is egter uitsonderings wat meebring dat 'n man byvoorbeeld 'n XX kombinasie kan hê.  Vir die doeleindes van hierdie artikel volstaan ons egter met die deursnee gegewe, naamlik, XY en XX chromosoompare vir mans en vrouens respektiewelik.

Genetiese model 46 Chromosome
Argitektuur van ’n lewende sel, die selkern, ‘n chromosoom, DNS en ’n enkele Geen

Die 23 chromosoom-pare van die menslike ras

Erkenning aan die Genetics Education Centre, Universiteit van Utah

Voordat oorerwing bespreek word, word die leser daarop gewys dat ’n kind die helfte (23) van sy/haar chromosome van sy/haar moeder ontvang en die helfte (23) van sy/haar vader.  In die diagram hier bo regs beskik die persoon oor een Y-chromosoom en een X-chromosoom.  Die persoon is dus manlik, en het sy Y-chromosoom vanaf sy vader en sy X-chromosoom vanaf sy moeder ontvang om ’n XY chromosoompaar te vorm.

 

OORERWING

Daar is hierbo uitvoerig beskryf hoe die gene van elke persoon die bloudruk vir daardie mens se liggaamskenmerke en lewe bevat.  As ’n persoon dus 23 chromosome van sy/haar vader en 23 chromosome van sy/haar moeder ontvang, het hy/sy dus ook sekere kenmerke en eienskappe van beide die Vader en Moeder ontvang.  Die vraag is nou waarom al die kinders van ’n ouerpaar dan nie presies eenders lyk nie.  Die volgende model is deur die Universiteit van Utah opgestel om die proses van oorerwing te illustreer.

Let daarop dat hierdie slegs ’n illustrasie is en geen verband hou met die werklike samestelling van die chromosome van die persone wie se name genoem word nie.

1ste Geslag: Cornelius Jansen en Trintke Marie: Duitse stamouers

2de Geslag: Zirke Jansen en Catharina Buys: Suid-Afrikaanse stamouers

3de Geslag: Roelof Andries Jansen en Elsie Elizabeth Vlotman: Eerste geslag Suid-Afrikaans gebore Jansen en sy eggenote

4de Geslag: Zirk Bernardus Jansen: Tweede Suid-Afrikaans-gebore Jansen en sy eggenote


Die voorstelling van die chromosome van die 1ste geslag kan soos volg geïllustreer word:

Cornelius se 46 Chromosome 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 Y 23 Chromosome vanaf Cornelius se Vader
CORNELIUS JANSEN  
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X 23 Chromosome vanaf Cornelius se Moeder
 EERSTE GESLAG  
 Trintke se 46 Chromosome 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X 23 Chromosome vanaf Trintke se Vader
TRINTKE MARIE  
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X 23 Chromosome vanaf Trintke se Moeder

 Chromosome van Vader en Moeder, 1ste geslag

Die byskrifte in die illustrasies wat hier gebruik word is veronderstel om selfverduidelikend te wees, maar word vir die eerste geslag kortliks bespreek.  Vir die doeleindes van hierdie bespreking is dit voldoende om slegs na die geslagschromosoompaar van beide Cornelius (YX) en Trintke (XX) te kyk. Die Y-chromosoon wat Cornelius vanaf sy vader ontvang het word in groen aangedui, en die X-chromosoom wat hy van sy moeder ontvang het, in blou.  Net so word die een  X-chromosoon wat Trintke vanaf haar vader ontvang het in geel aangedui, en die ander X-chromosoom wat sy vanaf haar moeder ontvang het, in pienk.

Die illustrasie toon duidelik hoe Cornelius se 46 chromosome opgedeel is in 23 chromosoompare.  Soos voorheen aangedui, ontvang sy afstammeling slegs 23 van sy chromosome.  Tydens die proses waar die spermsel vervaardig word (onder beheer van sekere gene), word ‘n seleksie gemaak vanuit beide die blou en groen chromosome vanuit Cornelius se totale aantal chromosome.  As ’n “groen 1” gekies word, is die “blou 1” uitgeskakel.  Net so, as die “groen Y” gekies word, is die “blou X” uitgeskakel.  Dieselfde patroon word vir die ander groen/blou keuses vir die spermsel gevolg om uiteindelik weer 23 chromosome te vorm.  Hierdie patroon word ook gevolg vir die samestelling van die 23 chromosome vir Trintke se eiersel.

Wanneer die spermsel en eiersel tydens bevrugting saamsmelt, bevat die gevolglike embrio weer 46 chromosome, maar hierdie keer ’n kombinasie uittreksel vanuit die vader en moeder se onderskeie chromosoompoele.  Dit kan soos volg voorgestel word vir die 2de geslag (Zirke, Cornelius en Trintke se seun):

Zirke se 46 Chromosome
(moontlike chromosoomsamestelling van 'n kind - in die voorbeeld 'n seun - van die 1ste Geslag)
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 Y 23 Chromosome vanaf Zirke se Vader
ZIRKE JANSEN  
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X 23 Chromosome vanaf Zirke se Moeder
 TWEEDE GESLAG  
Catharina se 46 Chromosome 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X 23 Chromosome vanaf Catharina se Vader
CATHARINA BUYS  
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X 23 Chromosome vanaf Catharina se Moeder

 Chromosome van 2de Geslag: 1ste geslag se seun (Zirke) en van Zirke se eggenote (Catharina).

 Dieselfde patroon soos hierbo word gevolg wanneer Zirke nou ’n kind (3de geslag) verwek by sy eggenote Catharina.  Die volgende twee geslagte se moontlike chromosoomsamestelling word hier onder geïllustreer:

Roelof se 46 Chromosome
(moontlike chromosoomsamestelling van 'n kind - in die voorbeeld 'n seun - van die 2de Geslag)
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 Y 23 Chromosome vanaf Roelof se Vader
ROELOF ANDRIES JANSEN  
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X 23 Chromosome vanaf Roelof se Moeder
 DERDE GESLAG  
Elsie se 46 Chromosome 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X 23 Chromosome vanaf Elsie se Vader
ELSIE ELISABETH VLOTMAN  
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X 23 Chromosome vanaf Elsie se Moeder

Chromosome van 3de Geslag: 2de geslag se seun (Roelof Andries) en van Roelof se eggenote (Elsie).

 

Zirk se 46 Chromosome
(moontlike chromosoomsamestelling van 'n kind - in die voorbeeld 'n seun - van die 3de Geslag)
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 Y 23 Chromosome vanaf Zirk se Vader
ZIRK BERNARDUS JANSEN  VIERDE GESLAG
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X 23 Chromosome vanaf Zirk se Moeder

Chromosome van 4de geslag:  3de geslag se seun (Zirk Bernardus).

Hierdie illustrasie toon duidelik hoe die “genetiese materiaal” van een geslag na die volgende oorgedra word, maar veral hoe vinnig die oorspronklike genetiese samestelling kan verdwyn.  So dra Zirk Bernardus Jansen in die 4de geslag net enkele van sy grootjie oupa Cornelius se chromosome (in die voorbeeld slegs 7 van die oorspronklike 23). Hier moet egter dadelik genoem word dat die keuse van chromosome vir die volgende geslag in hierdie voorbeeld lukraak deur die skrywer hiervan gekies is.  Die oorerwing kon enige ander kombinasie van chromosome tot gevolg gehad het.  Hiervolgens word die afleiding gemaak dat die “persentasie afkoms” wat vroeër deur Heese en andere bereken is (verwys na “Groep Sonder Grense” deur Heese), nie werklik wetenskaplik verantwoordbaar is nie.  Ons kan wel praat van die persentasie van voorgeslagte, maar verwys dan nie na genetiese materiaal nie.

 Die illustrasie toon voorts ook hoe die vier geslagte van mans (pa>seun>seun>seun) dieselfde Y-chromosoom dra.  Hierdie feit vorm die basis vir molekulêre genalogie: genealogie gebasseer op die analise van DNS op Y-chromosome.

 
Y-CHROMOSOON MERKERS

 ’n Manlike persoon se genetiese afkoms langs sy vaderlyn word bepaal deur die “volgorde” of sekwensie van die DNS op sy Y-chromosoom te bepaal.  Die basisvolgorde van die persoon se Y-DNS word vergelyk met die basisvolgorde van ’n ander man se Y-DNS.  Die basisvolgorde is ’n aanduiding van die tydsverloop vir elk tot by die voorvader wat hul gesamentlik deel (Mees Resente Gemeenskaplike Voorvader –MRGV).  Indien die pas perfek is, dan is die twee mans verwant aan mekaar en deel dieselfde “bloedlyn”.  Hulle kan dan hul onderskeie voorgeslagte navors totdat die gesogte MRGV gevind word.

Maar wat beteken hierdie basisvogorde-bepaling en hoe word dit gedoen?

Eerstens, en daar is breedvoerig hierbo daarna verwys, word wetenskaplik vasgestel in watter volgorde (sekwensie) die basismolekules (ons het hierbo daarna verwys as nukleotiedes) in ’n sekere posisie op die Y-DNS voorkom.  Die Y-chromosoom bevat reekse (sekwensies) van herhalende nukleotiedes.  Die aantal herhalings (alleles) verskil van persoon tot persoon.  Individuele Y-DNS sekwensies wat nuttig bevind is in genalogiese analise, word merkers genoem.  Elk van hierdie merkers het ’n naam, soos DYS391.  “DYS” beteken eenvoudig “DNS Y-Chromosoon Segment”, terwyl 391 die spesifieke sekwensie se identifikasienommer is.  Hierdie spesifieke merker verwys na die herhalende nukleotiedes (TCTA, in die geval van merker 391).  Indien TCTA 10 keer herhaal word op hierdie spesifieke plek op die Y-DNS, word hierdie merker aangedui as DYS391-10.  Die aantal herhalings word "repeats" genoem in molekulêre taal.

In die Y-DNS basisvolgorde bepaling van twee werlike afstammelinge van Zirke Jansen, die Suid-Afrikaanse Jansen stamvader, is die volgende vir spesifieke merkers (gene met spesifieke posisies op die Y-chromosoom van die persone) gevind:

Vir die DYS391 merker:

DYS391-10: TCTA word 10 keer herhaal;

 DYS391

 

Net so, vir die oorblywende 11 merkers:

Twee Manlike afstammelinge van ZB JANSEN (1800-1889): Tweede Neefs, twee keer verwyder
Agterkleinseun Agter-agter-agterkleinseun
Y-Chromosoom merker Kort Tandem Herhalings (KTH's) Y-chromosoom Merker Kort Tandem Herhalings (KTH's)
 DYS393  AGAT 13 keer herhaal  M393  AGAT 13 keer herhaal
 DYS390  TCTG of TCTA 22 keer herhaal  M390  TCTG of TCTA 22 keer herhaal
 DYS19  TAGA 14 keer herhaal  M19  TAGA 14 keer herhaal
 DYS385a  GAAA 13 keer herhaal  M385a  GAAA 13 keer herhaal
 DYS385b  GAAA 14 keer herhaal  M385b  GAAA 14 keer herhaal
 DYS439  GATA 11 keer herhaal  M439  GATA 11 keer herhaal
 DYS389 - 1  TCTG of TCTA 12 keer herhaal  M389 - 1  TCTG of TCTA 12 keer herhaal
 DYS392  TAT 11 keer herhaal  M392  TAT 11 keer herhaal
 DYS389 - 2  TCTG of TCTA 28 keer herhaal  M389 - 2  TCTG of TCTA 28 keer herhaal
 DYS438  TTTTC 10 keer herhaal  M438  TTTTC 10 keer herhaal
 DYS437  TCTA 16 keer herhaal  M437  TCTA 16 keer herhaal

 Die persoon links in die tabel se basisvolgorde is deur 'n laboratorium in Suid-Afrika bepaal, terwyl die persoon regs in die tabel se basisvolgorde by 'n laboratorium in die VSA bepaal is (vandaar die verskillende voorvoegsel "M").  Die Y-chromosoom DNS vir die twee persone is identies soos verwag sou word van twee bloedverwante met 'n onlangse manlike gemeenskaplike voorsaat via hul manlike afstammingslyn. Totdat anders bewys word, is bostaande die naaste aan tipiese manlike Jansen Y-chromosoom DNS waarop Jansenmans (afstammelinge van Zirke Jansen) aanspraak kan maak.

Die waardes (KTH's) van allelas , wanneer dit saamgevat word soos in die voorbeeld hierbo, verteenwoordig die persoon se DNS profiel.  Dit is hierdie stel getalle wat die persoon se direkte vaderlike lyn identifiseer.  Teoreties behoort alle manlike Jansen-afstammelinge in Suid-Afrika dus hierdie profiel te vertoon.  In die praktyk werk dit egter nie so eenvoudig nie!  Daar is te veel faktore wat ’n rol in hierdie verband speel.  Nie die minste hiervan nie is byvoorbeeld Jansen-seuns wat nie ’n Jansen-vader gehad het nie, maar wat nooit as sulks gerapporteer is nie.  Die volgorde bepaling van ’n groot aantal Jansen-mans sal nodig wees om ’n tipiese profiel vir die Jansens van Suid-Afrika te kan opstel (verwys na die laaste paragraaf aan die einde van hierdie artikel).  Daar vind soms ook op ’n natuurlike wyse lukrake mutasies plaas en wat dan gevolglik veroorsaak dat persone se DNS profiele verskil selfs al is hulle van dieselfde familie.

Waar 12-merker toetse die mees algemene Y-DNS toets in gebruik is, is die neiging deesdae om die meer betroubare 37-merker toets te laat doen met die oog op familienavorsing.  Eksakte ooreenstemming van die resultate van die 37-merker volgordebepaling van die Y-DNS van twee mans kan met tot 95% sekerheid aandui dat die twee persone 'n MRGV in die onlangse 8 geslagte deel.  Die 37-merker volgordebepaling word dus veral deur familienavorsers aangewend om genealogiese verwantskap tussen twee manlike persone te bepaal.

Die werklike Y-DNS 37 volgordes van die twee persone hierbo (2de Neefs, 2 keer verwyder), word in die volgende tabel opgesom:

Paneel 1 (1-12)
Merker DYS393 DYS390 DYS19 DYS391 DYS385 DYS426 DYS388 DYS439 DYS389I DYS392 DYS389II
KTH 13 22 14 10 13 - 14 11 14 11 12 11 28
Paneel 2 (13-25)
Merker DYS458 DYS459 DYS455 DYS454 DYS447 DYS437 DYS448 DYS449 DYS464
KTH 15 8 - 9 8 11 22 16 20 27 13 - 14 - 15 - 15
Paneel 3 (26-37)
Merker DYS460 Y-GATA-H4 YCAII DYS456 DYS607 DYS576 DYS570 CDY DYS442 DYS438
KTH 11 9 19 - 21 16 16 16 17 34 - 35 12 10

 
Hierdie genommerde resultate van ’n genealogiese Y-DNS toets word ’n haplotipe genoem.  ’n Groep van verskillende haplotipes kan ’n gemeenskaplike voorvader aandui, maar slegs met ’n waarskynlike sekerheid.  Heelwat meer as die eenvoudige toets wat hier beskryf word is nodig om met ’n groter mate van sekerheid te kan sê aan watter haplogroep ’n spesifieke haplotipe verbonde is.

Die tegnologie het reeds so ver gevorder dat die oorsprong en migrasiepatrone van ally Y-chromosome op aarde met molekulêre genealogie en haplogroepering bepaal kan word.   Lesers en belangstellende Jansen-genealoë sal dadelik wil weet waar die Jansens van SA se manlike voorvaders dan vandaan kom.  Die volgende hoofstuk verteenwoordig werklike resultate van sulke navorsing.

 
HAPLOGROEPERING: DIE JANSENS VAN SUID-AFRIKA

Soos kortliks hierbo genoem, word ‘n Genetiese Bevolkingsgroep wat met ‘n spesifieke geografiese omgewing en vroeë menslike migrasie-patroon geassosieer word, ‘n haplogroep genoem.  Die haplogroepering van die Jansen-familie van Suid-Afrika is dus aanduidend van waar hulle oer-adam gewoon het.  ’n Manlike persoon se haplotipe word bepaal deur volgordebepaling van die DNS van sy Y-chromosoom te doen.  Hierdie resultate word dan vergelyk met dieselfde toetsresultate (haplotipes) van ander manlike persone waarvoor die haplogroepering reeds bekend is.

Daar is reeds ’n hele aantal databasisse wêreldwyd vir molekulêre genealogie geskep.  Die mees omvattende hiervan, Family Tree DNA, het reeds die volgordebepaling van die DNS van etlike duisende manlike persone in hul databasis opgeneem.  Die Y-chromosoom merkers en genetiese volgordebepaling vir twee manlike Jansens van Suid-Afrika toon dat hulle aan die I1-Haplogroepering behoort.  Hiervolgens was die oervaders van Suid-Afrika se Jansens teen die einde van die laaste ys-tydperk (ongeveer 15 000 jaar gelede) hoofsaaklik in die noorde van die Iberiese skiereiland woonagtig.  Hierna, en namate die ys en gletsers noordwaarts gewyk het, het die draers van merker 253 (definiërende Merker vir I1) noordwaarts gemigreer om Wes-, Noordwes- en Noord-Europa te bevolk.  Hiervandaan het hulle ook Skandinawië beset. 

Genetic Journey

 Migrasie-roetes van die oervoorvaders van die Jansen-familie van Suid-Afrika

Erkenning aan die Genographic Project, National Geographic

Volgordebepaling van die DNS van 'n agter-agter-agterkleinseun van Zirk Bernardus Jansen ('n kleinseun van die Jansen stamvader, Zirke Jansen) toon 'n spesifieke migrasie-patroon vir sy Y-chromosoom oor 'n periode vanaf ongeveer 50 000 tot 15 000 jaar gelede.  Die betrokke Merkers, M168, M89, M170 en M253, word op die kaart hierbo aangedui.  Dit verteenwoordig die migrasiepad van die Y-chromosoom van die besproke nasaat van Zirke Jansen, en teoreties dan vir die Jansen-mans van Suid-Afrika.

Elke persoon op aarde dra DNS wat, soos breedvoerig hierbo verduidelik is, niks anders is as 'n kombinasie van gene wat vanaf elk se vader en moeder ontvang is nie.  Hierdie gene gee aan elke persoon individuele eienskappe soos kleur van die oë, atletiese vermoëns, vatbaarheid vir siektes, ensovoorts.  Daar is egter een uitsondering, naamlik die Y-chromosoom, wat onveranderd van geslag tot geslag slegs vanaf 'n vader na sy seuns oorgedra word.  Onveranderd, behalwe as 'n mutasie, gewoonlik sonder nadelige gevolge, op 'n natuurlike wyse tussen twee opeenvolgende geslagte plaasvind.  Hierdie mutasie, bekend as 'n Merker, kan dan as 'n baken in tyd gebruik word en wat gekarteer kan word vir 'n spesifieke afkomslyn in 'n familie.  Die mutasie, of dan wel die Merker, kan vanaf die eerste voorkoms oor duisende jare vanaf vader na seun oorgedra word.  Elke Merker is effektief die begin van 'n nuwe tak in die genetiese familieboom van die mensdom.  Naspeuring van die takke in terme van geografiese gebiede, gee dan aan navorsers 'n aanduiding van die migrasiepad van 'n spesifieke Y-chromosoom in tyd.

'n Haplogroep, soos hierbo verduidelik, word gedefinieer deur 'n reeks Merkers wat gedeel word deur ander mans wat dieselfde mutasie in hul voorgeslagte ondergaan het.  Die Merkers speur 'n pad na wat die spesifieke voorgeslagte gevolg het nadat hulle Afrika verlaat en Europa bevolk het.  Dit wat hierna volg is 'n kort bespreking van die migrasiepad van Suid-Afrika se manlike Jansens vanaf die ontstaan van die eerste bekende merker tot en met die laaste:

M168 - Die vroegste bekende Jansen voorvader

Ontstaan: ca 50 000 jaar gelede
Leefwyse: Jagters, Klipwerktuie en eerste bewyse van Kuns en Gevorderde Konseptuele eienskappe.

Skelet- en argeologiese bewyse toon dat die moderne mens teen ongeveer 200 000 jaar gelede in Afrika ge-evolueer het.  Die man wat aanleiding gegee het tot Merker 168 het ongeveer 50 000 jaar gelede in die Noord-Ooste van Afrika geleef in die Groot Slenkdal, waarskynlik in die teenswoordige Ethiopië, Kenia of Tanzanië.  Hierdie man se nageslag was die enigste lyn wat buite Afrika oorleef het.  Dit maak van hom die gemeenskaplike voorvader van alle nie-Afrika mans wat vandag leef.

Klimaatsverandering is waarskynlik die rede waarom hierdie oervaders noordwaarts migreer het.  Namate die ysvelde van Suid-Europa gesmelt het en warmer en vogtiger klimaatstoestande in Noord-Afrika gevestig is en die Sahara in bewoonbare Savanne omvorm is, het die diereryk Noordwaarts oor die groen grasryke vlaktes begin migreer.  Die draers van M168 het noodwendig en op 'n natuurlike wyse in die spore van hierdie diere gevolg.  Hulle was jagters en baie afhanklik van die bewegings van die diere wat hulle vernaamste bron van voedsel was.

M89 - Migrasie vanuit Afrika na die Midde-Ooste

Ontstaan: ca 45 000 jaar gelede
Leefwyse: Jagters, Klipwerktuie, Ivoor en Hout.

Die volgende Merker in die Haplogroep I1-lyn is M89, 'n Merker wat in 90 to 95% van alle nie-Afrika mans voorkom.  Hierdie voorvader is ongeveer 45 000 jaar gelede gebore, ook in Noord-Afrika, of dalk in die midde-Ooste.  Die eerste groep mense wat die draers was van M89 en wat Afrika verlaat het, het die kusroete ooswaarts gevolg en uiteindelik in Australië geëindig.  Die tweede vlaag van Afrika emmigrante wat draers was van M89, het die vrugbare en groen grasvlaktes en oorvloed wild na die midde-Ooste gevolg.  Op hierdie tydstip, ongeveer 40 000 jaar gelede, het die klimaat in Noord-Afrika dramaties verander. Dit het kouer geword en die reënval het verlaag.  Noord-Afrika het in 'n woestyn verander en die toegangspoort tussen Afrika en Europa is effektief gesluit.  Vir die volgende 20 000 jaar sou daar geen noemenswaardige migrasie vanuit Afrika na Europa plaasvind nie.  Die draers van M89 het twee keuses gehad: Hulle kon aanbly in die midde-ooste of hulle kon verder intrek in die Europese kontinent.

Terwyl baie in die midde-ooste aangebly het, het daar net so baie verder agter die reuse troppe wild aangetrek tot in die hedendaagse Iran en die groot grasvlaktes van sentraal-Asië.  'n Klein groepie het die migrasie-pad deur die gebiede van die hedendaagse Irak en Sirië, na Anatolië (die latere landstreek van die Hettiete van Bybelse faam en vandag Turkye) gelei.

M170 - Die Balkans en Sentraal Europa

Ontstaan: ca 20 000 jaar gelede
Leefwyse:
Boonste Paleolitiese Era ,Jagters, Klipwerktuie, Gravette-kultuur

Die volgende stap in die migrasie-patroon van Haplogroep I1 was die Weswaartse verspreiding van die draers van merker M89 via die hedendaagse Turkye, Suid van die Swartsee na die omgewing van die Balkan Lande en spoedig ook na Sentraal Europa waar die hedendaagse Bulgarye, Serwië, Roemenië, Hongarye en Oostenryk geleë is.  Die migrasiepad het hierna 'n roete Noord van die Alpe na Suid-Oos Frankryk gevolg.  Daar word vermoed dat hierdie groep verantwoordelik was vir die ontstaan en verspreiding van die sogenaamde Gravette-kultuur van Frankryk.

Die Gravette-kultuur verteenwoordig die tweede ontwikkelingsfase van Paleolitiese Wes-Europa vanaf ongeveer 28 000 tot 21 000 jaar gelede.  Die kultuur is vernoem na 'n terrein in La Gravette in Frankryk waar bewyse vir die bestaan van hierdie prehistoriese mense vir die eerste keer gevind is.  Hulle was bekend vir die vervaardiging van klipwerktuie wat hulle duidelik onderskei het van enige vorige groeperings.  Hierdie werktuie was smal en dun met 'n skerp punt wat veral vir die jag van grootwild gebruik is.  Hulle was ook verantwoordelik vir die kerf van die sogenaamde Venus-figure wat uit hierdie omgewing en periode afkomstig is.  Die foto hieronder is van een so 'n figuur wat uit tand-ivoor gekerf is.  Hierdie besondere figuur toon ook duidelik dat hierdie mense waarskynlik die weefkuns bemeester het (hierdie besondere figuur toon 'n geweefde kledingstuk om haar agterkant te bedek).

 Gravette Lemme


La Gravette Lemme

Venus Rekonstruksie 

Venus beeldjie (rekonstruksie van beskadigde voorkant)

Venus Agterkant

 Venus beeldjie (agterkant met geweefde kledingstuk)
 Foto: http://www.photo.rmn.fr/cf/htm/CPicZ.aspx?E=2C6NU0HDAFRX  Foto: M. Burkitt 'The Old Stone Age'  Foto: T. Powell 'Prehistoric Art'

Hierdie pre-historiese Europese bewoners het in groepe saamgewerk om die reuse Mammoete te jag vir hulle vleis, ivoor en beendere.  Hulle het die ivoor gebruik om implemente, beelde en ornamente te kerf, maar het ook skulp-juwele gemaak.  Hulle het die beendere van mammoete onder andere gebruik om woonplekke te bou.

Die draer van die volgende merker (M170) van Haplogroep I1, is omstreeks 20 000 jaar gelede in sentraal Europa gebore en was 'n erfgenaam van die ontwikkelde Gravette-kultuur van sy eie voorvaders.  Hierdie was die hoogtepunt van die laaste ys-tydperk en die eerste draer van M170 is waarskynlik in een van die afgeleë skuilingsgebiede gebore waar hy en sy ouers beskerming teen die koue gesoek het.

M253 - Die Iberiese Skiereiland

Ontstaan: ca 15 000 jaar gelede
Leefwyse: Boonste Paleolitiese era, Jagter-versamelaas

Tussen 20 000 en 15 000 jaar gelede moes die menslike bewoners van Europa redelik ver suid trek om te skuil teen die koue en ys wat op daardie tydstip die hele kontinent bedek het.  Hulle het hierdie skuiling suid van die Pireneë gevind op die Iberiese Skiereiland.  Terwyl hulle geografies heeltemaal geïsoleer was van die res van Europa, het daar 'n baie kenmerkende mutasie plaasgevind op die DNS van 'n seun van een van die draers van die M170 merker.  Dit was op hierdie stadium, ongeveer 15 000 jaar gelede dat die kenmerkende M253 merker vir die heel eerste keer op die DNS van 'n manlike voorvader verskyn het.

Namate die aarde verwarm en die ysvelde gewyk het, het die inwoners van die Skiereiland noordwaarts begin migreer en die Europese kontinent herbeset.  Saam met hulle was die draers van M253, die kenmerkende en tiperende merker van Haplogroep I1.  Hierdie merker word vandag steeds in groot persentasies gevind onder die tradisionele manlike inwoners van Noord-Wes Europa.

'N GENETIESE STAMBOOM VIR DIE JANSENS

Die gedateerde en gekarteerde "M168 > M89 > M170 > M253" stamboom deur ongeveer vyftig milennia, verteenwoordig die genetiese padkaart waarlangs die biologiese voorvaders van Haplogroepering I1 baie lank gelede geloop het.  Die Jansens van Suid-Afrika behoort aan hierdie groepering.


Haplogroepering: I1 (M253)

Y-Chromosoom merkers vir I1: M168 > P143 > M89 > L15 > P123 > M170 > M253
  (Minder is bekend van sekere merkers as van ander - die outeur hiervan het gevolglik besluit om die merkers waaroor onsekerheid bestaan,  vir eers uit te laat vanuit die beskrywing totdat meer bekend is daaroor)
 

Tydlyn (jare gelede) vir I1: 50 000 > P143 > 45 000 > L15 > P123 > 20 000 > 15 000

Geografiese Roete vir I1 merkers sedert ontstaan van die 1ste merker (M168):

Boonste Paleolitiese Periode (Laat Steentydperk - 50 000 jaar tot 10 000 jaar voor Christus)
Migrasie van die voorgeslagte van Haplogroepering I1

Groot Slenkdal, Oos-Afrika
50 000 vC
M168 ----------------->

 

 

Noord-Afrika/Midde-Ooste
45 000 vC
M89 ----------------->

 

 


Balkans en Sentraal Europa
20 000 vC
M170 ----------------->

 

 

 



Iberiese Skiereiland
15 000 vC
M253 -------------------->

 

 

Nie Europese Banier

 

 DIE JANSEN-PROJEK: 'N GENETIESE PROFIEL

Ferdie wil baie graag so veel as moontlik Jansen-mans se 12-Merker Y-DNS basisvolgordes bekom.  Die doelstelling is om 'n tipiese profiel vir ons familie te identifiseer. Hoe meer mans deelneem, hoe akkurater en meer betroubaar sal die uitkoms wees.  Dis heeltemaal veilig om deel te neem aan die projek, want geen persoons-name word saam met Y-DNS resultate gepubliseer nie.

Indien jy belang stel om deel te neem aan die projek, gaan dan soos volg te werk om jou eie persoonlike Y-DNS basisvolgorde te bekom:

Besoek "Family Tree DNA" se webwerf op die internet en registreer as 'n gebruiker.  Dit is dan 'n eenvoudige proses om jou eie 12-merker Y-DNS basisvolgordes te laat bepaal.  Jy sal versoek word om vooruit te betaal vir die toets, waarna die nodige apparatuur aan jou versend sal word.  Jy versamel self die toets-monsters in twee klein proefbuisies, by jou huis en pos dit dan aan die laboratorium.  Jy sal jou verslag binne ongeveer 6 tot 8 weke ontvang.    Ses toetse is reeds voltooi vir persone langs die manlike afstammingslyn vanaf Cornelius en sy seun Zirke Jansen:

Toetsstel 391  393  390  19   385a 385b 439  389/1 392   389/2 438   437   426  388 
DP66514  10  13 22  14  13   14  11  12  11  28 10  16   -  -
N108489 10  13  22  14  13 14  11   12  11  28  10 16   11  14
282732  10  13 22   14  13 14  11   12 11 28   - 11   14
299318 10 13 22 14 13 14 11 12 11 28 - - 11 14
206557 10 13 22 14 13 14 11 12 11 28 10 16 11 14
413209 10 13 22 14 13 14 11 12 11 28 10 16 11 14

 Kort Tandemherhalings van die Y-DNS van deelnemende Suid-Afrikaanse Jansen-mans.

 

Nageslag van Cornelius Jansen, Neustadtgödens, Oos-Friesland, gebore ca 1700: Manlike afstammingslyn: Alle takke
  391 393 390 19 385a 385b 439 389/1 392 389/2 438 437 426 388
Min 10 13 22 14 13 14 11 12 11 28 10 16 11 14
Maks 10 13 22 14 13 14 11 12 11 28 10 16 11 14
Modus 10 13 22 14 13 14 11 12 11 28 10 16 11 14

Die tipiese Y-DNS profiel van JANSEN-mans, nageslag van Cornelius Jansen, die Suid-Afrikaanse JANSEN-patriarg.
Let asseblief op dat hierdie resultate dui op die Y-DNS profiel van (#32) Zirk Bernardus Jansen ('n kleinseun van die Jansen-stamvader).  Drie van Z.B. Jansen se seuns se nageslagte, volgens patronimiese navorsing, dui hom aan as die mees onlangse gemeenskaplike voorsaat van die persone wat hul toetsresultate aangebied het vir die projek.



TERUG NA BO

Nie Europese Banier